shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(FAM129C-shRNA-Seq1)(CAT#: AdV-SI0427WQ)
This product is a FAM129C-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Based on location and expression of FAM129C gene, this would suggest it has a role in immune system function. The expression of FAM129C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | FAM129C-shRNA-Seq1 |
| Related Target/Protein | FAM129C |
| Region | CDS |
| TargetSeq | CTGAATCCTTGGGAGACCATA |
| NCBI RefSeq | NM_173544 |
| Alternative Names | BCNP1; FAM129C |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Colorectal cancer |
