shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Fbxw16-shRNA-Seq1)(CAT#: AdV-SI1836WQ)
This product is a Fbxw16-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Fbxw16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Fbxw16-shRNA-Seq1 |
Related Target/Protein | Fbxw16 |
Region | CDS |
TargetSeq | CATATTCTCTCCCTGTCAAAT |
NCBI RefSeq | NM_177070 |
Alternative Names | 7420402K12Rik |
Titer | >1*10^10 GC/mL |