shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(HSPA13-shRNA-Seq2)(CAT#: AdV-SI0362WQ)
This product is a HSPA13-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by HSPA13 gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The expression of HSPA13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | HSPA13-shRNA-Seq2 |
Related Target/Protein | HSPA13 |
Region | CDS |
TargetSeq | CAATGATGTATATGTGGGATA |
NCBI RefSeq | NM_006948 |
Alternative Names | STCH |
Titer | >1*10^10 GC/mL |
Related Diseases | Oral Cancer |