shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(HSPA13-shRNA-Seq2)(CAT#: AdV-SI0362WQ)

This product is a HSPA13-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by HSPA13 gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The expression of HSPA13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert HSPA13-shRNA-Seq2
Related Target/Protein HSPA13
Region CDS
TargetSeq CAATGATGTATATGTGGGATA
NCBI RefSeq NM_006948
Alternative Names STCH
Titer >1*10^10 GC/mL
Related Diseases Oral Cancer
Target Gene
Gene ID 6782
Uniprot ID P48723

Related Products