shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(LOC441799-shRNA-Seq4)(CAT#: AdV-SI1575WQ)
This product is a LOC441799-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of LOC441799-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | LOC441799-shRNA-Seq4 |
| Related Target/Protein | LOC441799 |
| Region | CDS |
| TargetSeq | GTGTACTTGCTCAGTTTCCCT |
| NCBI RefSeq | XM_497554 |
| Titer | >1*10^10 GC/mL |
