shRNA Lentivirus (self-inactivating), p7SK-(2510003E04Rik-shRNA-Seq1)(CAT#: LV-SI3919WQ)

This product is a 2510003E04Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2510003E04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 2510003E04Rik-shRNA-Seq1
Related Target/Protein 2510003E04Rik
Region 3UTR
TargetSeq CCTAATTATGTAAGTTGCCTT
NCBI RefSeq NM_028197
Alternative Names KBP; mKIAA1279; 0710007C18Rik; Kif1bp
Titer >1*10^10 GC/mL
Target Gene
Gene ID 72320
Uniprot ID H3BIY2

Related Products