shRNA Lentivirus (self-inactivating), p7SK-(4930447C04Rik-shRNA-Seq2)(CAT#: LV-SI3563WQ)
This product is a 4930447C04Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 4930447C04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | 4930447C04Rik-shRNA-Seq2 |
Related Target/Protein | 4930447C04Rik |
Region | CDS |
TargetSeq | GACTCTGGTATGGATAGTAAT |
NCBI RefSeq | NM_029444 |
Alternative Names | Six6OS; Six6as; Six6os1; 4921504I02Rik; A930035O15Rik |
Titer | >1*10^10 GC/mL |