shRNA Lentivirus (self-inactivating), p7SK-(Adm2-shRNA-Seq2)(CAT#: LV-SI3662WQ)
This product is a Adm2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Adm2 gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis. The expression of Adm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Adm2-shRNA-Seq2 |
Related Target/Protein | Adm2 |
Region | CDS |
TargetSeq | CATGCCAAGTCCAGAATCTTA |
NCBI RefSeq | NM_182928 |
Alternative Names | AM2; dJ579N16.4 |
Titer | >1*10^10 GC/mL |
Related Diseases | Gastrointestinal and cardiovascular disease |