shRNA Lentivirus (self-inactivating), p7SK-(AI837181-shRNA-Seq3)(CAT#: LV-SI3532WQ)
This product is a AI837181-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of AI837181-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | AI837181-shRNA-Seq3 |
Related Target/Protein | AI837181 |
Region | 3UTR |
TargetSeq | CCTTTGCACTTCTGCTCTCTT |
NCBI RefSeq | NM_134149 |
Alternative Names | Bles03; N28173 |
Titer | >1*10^10 GC/mL |