shRNA Lentivirus (self-inactivating), p7SK-(AI837181-shRNA-Seq3)(CAT#: LV-SI3532WQ)

This product is a AI837181-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of AI837181-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert AI837181-shRNA-Seq3
Related Target/Protein AI837181
Region 3UTR
TargetSeq CCTTTGCACTTCTGCTCTCTT
NCBI RefSeq NM_134149
Alternative Names Bles03; N28173
Titer >1*10^10 GC/mL
Target Gene
Gene ID 107242
Uniprot ID Q8VD62

Related Products