shRNA Lentivirus (self-inactivating), p7SK-(ANKRD20A1-shRNA-Seq2)(CAT#: LV-SI1203WQ)

This product is a ANKRD20A1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of ANKRD20A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert ANKRD20A1-shRNA-Seq2
Related Target/Protein ANKRD20A1
Region CDS
TargetSeq CAAGTTCACATGCCGTTGATA
NCBI RefSeq NM_032250
Alternative Names ANKRD20A
Titer >1*10^10 GC/mL
Related Diseases Behçet's disease
Target Gene
Gene ID 84210
Uniprot ID Q5TYW2

Related Products