shRNA Lentivirus (self-inactivating), p7SK-(ARMC4-shRNA-Seq2)(CAT#: LV-SI1090WQ)

This product is a ARMC4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ARMC4 gene encoded protein contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. The expression of ARMC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert ARMC4-shRNA-Seq2
Related Target/Protein ARMC4
Region CDS
TargetSeq CACTGACAATAAAGAGCGGTT
NCBI RefSeq NM_018076
Alternative Names CILD23
Titer >1*10^10 GC/mL
Related Diseases Primary ciliary dyskensia (PCD)
Target Gene
Gene ID 55130
Uniprot ID Q5T2S8

Related Products