shRNA Lentivirus (self-inactivating), p7SK-(C21orf2-shRNA-Seq1)(CAT#: LV-SI1354WQ)

This product is a C21orf2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C21orf2 gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. The expression of C21orf2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C21orf2-shRNA-Seq1
Related Target/Protein C21orf2
Region 3UTR
TargetSeq GTTGTGACAGTCTTCCTGAAA
NCBI RefSeq NM_004928
Alternative Names RDMS; SMDAX; LRRC76; YF5/A2; CFAP410
Titer >1*10^10 GC/mL
Related Diseases Amyotrophic lateral sclerosis, Down syndrome (DS) brain
Target Gene
Gene ID 755
Uniprot ID O43822

Related Products