shRNA Lentivirus (self-inactivating), p7SK-(C21orf2-shRNA-Seq2)(CAT#: LV-SI1355WQ)
This product is a C21orf2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C21orf2 gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. The expression of C21orf2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C21orf2-shRNA-Seq2 |
| Related Target/Protein | C21orf2 |
| Region | CDS |
| TargetSeq | GATATCTCCATTTGCCAGGAG |
| NCBI RefSeq | NM_004928 |
| Alternative Names | RDMS; SMDAX; LRRC76; YF5/A2; CFAP410 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Amyotrophic lateral sclerosis, Down syndrome (DS) brain |
