shRNA Lentivirus (self-inactivating), p7SK-(C21orf93-shRNA-Seq1)(CAT#: LV-SI1255WQ)
This product is a C21orf93-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C21orf93-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C21orf93-shRNA-Seq1 |
| Related Target/Protein | C21orf93 |
| Region | 3UTR |
| TargetSeq | GAAACTGAACATCTCCAAGTA |
| NCBI RefSeq | NM_145179 |
| Alternative Names | NCRNA00315; LINC00315 |
| Titer | >1*10^10 GC/mL |
