shRNA Lentivirus (self-inactivating), p7SK-(C21orf93-shRNA-Seq1)(CAT#: LV-SI1255WQ)
This product is a C21orf93-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C21orf93-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C21orf93-shRNA-Seq1 |
Related Target/Protein | C21orf93 |
Region | 3UTR |
TargetSeq | GAAACTGAACATCTCCAAGTA |
NCBI RefSeq | NM_145179 |
Alternative Names | NCRNA00315; LINC00315 |
Titer | >1*10^10 GC/mL |