shRNA Lentivirus (self-inactivating), p7SK-(C3orf15-shRNA-Seq2)(CAT#: LV-SI1461WQ)
This product is a C3orf15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C3orf15 gene may play a role in spermatogenesis and regulate cilium motility through its role in the assembly of the axonemal radial spokes. The expression of C3orf15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C3orf15-shRNA-Seq2 |
| Related Target/Protein | C3orf15 |
| Region | 3UTR |
| TargetSeq | CCTGATTCAAAGACTGTCAAA |
| NCBI RefSeq | NM_033364 |
| Alternative Names | AAT1; CFAP91; MAATS1; CaM-IP2; SPATA26; AAT1alpha |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Kartagener syndrome |
