shRNA Lentivirus (self-inactivating), p7SK-(Csn1s2a-shRNA-Seq2)(CAT#: LV-SI3544WQ)

This product is a Csn1s2a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Csn1s2a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Csn1s2a-shRNA-Seq2
Related Target/Protein Csn1s2a
Region CDS
TargetSeq GATTCTACTAAGATTCCTAAA
NCBI RefSeq NM_007785
Alternative Names CSN1S2AP; CSN1S2A
Titer >1*10^10 GC/mL
Target Gene
Gene ID 286828
Uniprot ID Q8IUJ1

Related Products