shRNA Lentivirus (self-inactivating), p7SK-(Ctu2-shRNA-Seq5)(CAT#: LV-SI3492WQ)

This product is a Ctu2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Ctu2 gene a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs) and plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. The expression of Ctu2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Ctu2-shRNA-Seq5
Related Target/Protein Ctu2
Region CDS
TargetSeq CCAGGAGTCATCTATGTTGAT
NCBI RefSeq NM_153775
Alternative Names MFRG; NCS2; UPF0432; C16orf84
Titer >1*10^10 GC/mL
Target Gene
Gene ID 348180
Uniprot ID Q2VPK5

Related Products