shRNA Lentivirus (self-inactivating), p7SK-(DKFZp434P055-shRNA-Seq1)(CAT#: LV-SI1329WQ)

This product is a DKFZp434P055-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of DKFZp434P055-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert DKFZp434P055-shRNA-Seq1
Related Target/Protein DKFZp434P055
Region CDS
TargetSeq CTGAACGCATAGAAGCTCTAA
NCBI RefSeq NM_173466
Titer >1*10^10 GC/mL

Related Products