shRNA Lentivirus (self-inactivating), p7SK-(DPY19L4-shRNA-Seq2)(CAT#: LV-SI3889WQ)
This product is a DPY19L4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by DPY19L4 gene is probable C-mannosyltransferase that mediates C-mannosylation of tryptophan residues on target proteins. The expression of DPY19L4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | DPY19L4-shRNA-Seq2 |
| Related Target/Protein | DPY19L4 |
| Region | 3UTR |
| TargetSeq | CCTCATCTACTGCTTATGTTA |
| NCBI RefSeq | NM_181787 |
| Titer | >1*10^10 GC/mL |
