shRNA Lentivirus (self-inactivating), p7SK-(FAM129C-shRNA-Seq1)(CAT#: LV-SI1429WQ)
This product is a FAM129C-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Based on location and expression of FAM129C gene, this would suggest it has a role in immune system function. The expression of FAM129C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | FAM129C-shRNA-Seq1 |
Related Target/Protein | FAM129C |
Region | CDS |
TargetSeq | CTGAATCCTTGGGAGACCATA |
NCBI RefSeq | NM_173544 |
Alternative Names | BCNP1; FAM129C |
Titer | >1*10^10 GC/mL |
Related Diseases | Colorectal cancer |