shRNA Lentivirus (self-inactivating), p7SK-(KIAA1841-shRNA-Seq3)(CAT#: LV-SI1222WQ)
This product is a KIAA1841-shRNA encoding Lentivirus, which is based on HIV-1 serotype. KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription. The expression of KIAA1841-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | KIAA1841-shRNA-Seq3 |
Related Target/Protein | KIAA1841 |
Region | CDS |
TargetSeq | GCAAGTTCATTGAATACTGTT |
NCBI RefSeq | NM_032506 |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung adenocarcinoma |