shRNA Lentivirus (self-inactivating), p7SK-(LOC154872-shRNA-Seq1)(CAT#: LV-SI1265WQ)

This product is a LOC154872-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of LOC154872-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LOC154872-shRNA-Seq1
Related Target/Protein LOC154872
Region CDS
TargetSeq CCTGAAATCACGCAGGATGAA
NCBI RefSeq NM_001024603
Alternative Names C7orf77
Titer >1*10^10 GC/mL
Target Gene
Gene ID 154872
Uniprot ID A4D0Y5

Related Products