shRNA Lentivirus (self-inactivating), p7SK-(LOC286238-shRNA-Seq1)(CAT#: LV-SI1083WQ)

This product is a LOC286238-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LOC286238 is an RNA Gene, and is affiliated with the ncRNA class. The expression of LOC286238-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LOC286238-shRNA-Seq1
Related Target/Protein LOC286238
Region CDS
TargetSeq CAGCAAGGAATAGCAGTGAAA
NCBI RefSeq XM_379684
Titer >1*10^10 GC/mL
Related Diseases Cardiovascular disease (CVD)

Related Products