shRNA Lentivirus (self-inactivating), p7SK-(LOC286238-shRNA-Seq2)(CAT#: LV-SI1084WQ)

Datasheet

This product is a LOC286238-shRNA encoding Lentivirus, which is based on HIV-1 serotype. LOC286238 is an RNA Gene, and is affiliated with the ncRNA class. The expression of LOC286238-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LOC286238-shRNA-Seq2
Related Target/Protein LOC286238
Region CDS
TargetSeq GAGACCTGGAAATGTGTTCAT
NCBI RefSeq XM_379684
Titer >1*10^10 GC/mL
Related Diseases Cardiovascular disease (CVD)

Related Products

Recombinant lentivirus, pU6-(Mouse JAK2-Flag), Overexpression (CAT#:Lenti-GTOH0284WQ) shRNA Lentivirus (self-inactivating), pH1-(LOC154872-shRNA-Seq2) (CAT#:LV-SI0765WQ) Recombinant lentivirus, pU6-(Human TRIM65), Overexpression (CAT#:Lenti-GTOH0106WQ) Recombinant lentivirus, pU6-(Human hsa-miR-506-3p), Overexpression (CAT#:Lenti-GTOH0724WQ) shRNA Lentivirus (self-inactivating), pH1-(OR5A1-shRNA-Seq2) (CAT#:LV-SI2475WQ) shRNA Lentivirus (self-inactivating), p7SK-(OR52E5-shRNA-Seq1) (CAT#:LV-SI3298WQ) Recombinant lentivirus, pU6-(Human hsa-let-7b), Overexpression (CAT#:Lenti-GTOH0310WQ) shRNA Lentivirus (self-inactivating), pU6-(OR4F3-shRNA-Seq2) (CAT#:LV-SI1677WQ)