shRNA Lentivirus (self-inactivating), p7SK-(MORC2-shRNA-Seq1)(CAT#: LV-SI1377WQ)
This product is a MORC2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MORC2 gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The expression of MORC2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | MORC2-shRNA-Seq1 |
Related Target/Protein | MORC2 |
Region | CDS |
TargetSeq | CATCTATAAGTACTCTCCATT |
NCBI RefSeq | NM_014941 |
Alternative Names | ZCW3; CMT2Z; ZCWCC1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |