shRNA Lentivirus (self-inactivating), p7SK-(N4bp2l2-shRNA-Seq3)(CAT#: LV-SI3618WQ)

This product is a N4bp2l2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The N4bp2l2 gene has enzyme binding and transcription corepressor activity. The expression of N4bp2l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert N4bp2l2-shRNA-Seq3
Related Target/Protein N4bp2l2
Region CDS
TargetSeq CCAAGGATGATGAAATCTATA
NCBI RefSeq NM_201369
Alternative Names CG005; CG016; PFAAP5; 92M18.3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 10443
Uniprot ID Q92802

Related Products