shRNA Lentivirus (self-inactivating), p7SK-(Olfr1462-shRNA-Seq5)(CAT#: LV-SI3776WQ)

This product is a Olfr1462-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr1462 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1462-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr1462-shRNA-Seq5
Related Target/Protein Olfr1462
Region CDS
TargetSeq CCATCTATACAGTGGATGTAT
NCBI RefSeq NM_146693
Alternative Names MOR202-13
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258688
Uniprot ID Q8VFW3

Related Products