shRNA Lentivirus (self-inactivating), p7SK-(Olfr151-shRNA-Seq1)(CAT#: LV-SI3965WQ)

This product is a Olfr151-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr151 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr151-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr151-shRNA-Seq1
Related Target/Protein Olfr151
Region CDS
TargetSeq CCACAGCATTCATGTACTTAA
NCBI RefSeq NM_207664
Alternative Names M71; MOR171-2
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 406176
Uniprot ID Q60893

Related Products