shRNA Lentivirus (self-inactivating), p7SK-(OR9A2-shRNA-Seq2)(CAT#: LV-SI3391WQ)
This product is a OR9A2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR9A2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR9A2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | OR9A2-shRNA-Seq2 |
Related Target/Protein | OR9A2 |
Region | CDS |
TargetSeq | CCTTTGAGGTACAACATCATT |
NCBI RefSeq | XM_069609 |
Titer | >1*10^10 GC/mL |
Related Diseases | Olfactory dysfunction |