shRNA Lentivirus (self-inactivating), p7SK-(PCMTD1-shRNA-Seq2)(CAT#: LV-SI1078WQ)
This product is a PCMTD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. PCMTD1 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-L-isoaspartate (D-aspartate) O-methyltransferase activity. The expression of PCMTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PCMTD1-shRNA-Seq2 |
| Related Target/Protein | PCMTD1 |
| Region | 3UTR |
| TargetSeq | GCTCCAGTAATTCCACAACAT |
| NCBI RefSeq | NM_052937 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Glaucoma, Lung cancer |
