shRNA Lentivirus (self-inactivating), p7SK-(Rsrc2-shRNA-Seq1)(CAT#: LV-SI3974WQ)

This product is a Rsrc2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Rsrc2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Rsrc2-shRNA-Seq1
Related Target/Protein Rsrc2
Region CDS
TargetSeq GCGATTAAATTCATCTGAGAA
NCBI RefSeq NM_001005523
Titer >1*10^10 GC/mL
Target Gene
Gene ID 65117
Uniprot ID Q7L4I2

Related Products