shRNA Lentivirus (self-inactivating), p7SK-(SAMD8-shRNA-Seq2)(CAT#: LV-SI1443WQ)

This product is a SAMD8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. SAMD8 is an endoplasmic reticulum (ER) transferase that has no sphingomyelin synthase activity but can convert phosphatidylethanolamine (PE) and ceramide to ceramide phosphoethanolamine (CPE) albeit with low product yield. The expression of SAMD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SAMD8-shRNA-Seq2
Related Target/Protein SAMD8
Region CDS
TargetSeq GTAGTCTGATGGGAACTGTAT
NCBI RefSeq NM_144660
Alternative Names SMSr; HEL-177
Titer >1*10^10 GC/mL
Related Diseases Bilateral Hearing Impairment
Target Gene
Gene ID 142891
Uniprot ID Q96LT4

Related Products