shRNA Lentivirus (self-inactivating), p7SK-(SELRC1-shRNA-Seq2)(CAT#: LV-SI1308WQ)

This product is a SELRC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SELRC1 gene is required for assembly of mitochondrial respiratory chain complex I and complex IV. The expression of SELRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SELRC1-shRNA-Seq2
Related Target/Protein SELRC1
Region CDS
TargetSeq GTGTGAGAAGCCTGGAAAGAA
NCBI RefSeq NM_023077
Alternative Names RESA1; SCAN3; COA7; C1orf163
Titer >1*10^10 GC/mL
Related Diseases Respiratory disease
Target Gene
Gene ID 65260
Uniprot ID Q96BR5

Related Products