shRNA Lentivirus (self-inactivating), p7SK-(SPANXN3-shRNA-Seq1)(CAT#: LV-SI1194WQ)

Datasheet

This product is a SPANXN3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of SPANXN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SPANXN3-shRNA-Seq1
Related Target/Protein SPANXN3
Region 3UTR
TargetSeq GATGGCGATGATTACAATAAA
NCBI RefSeq NM_001009609
Alternative Names CT11.8; SPANX-N3
Titer >1*10^10 GC/mL
Related Diseases Ovarian cancer
Target Gene
Gene ID 139067
Uniprot ID Q5MJ09

Related Products

Recombinant lentivirus, pU6-(Human hsa-miR-27b), Overexpression (CAT#:Lenti-GTOH0228WQ) LKD-EF1a (EGFP-P2A-LUC-T2A-Puro)-U6 (shRNA) (CAT#:Lenti-GTXH009WQ) shRNA Lentivirus (self-inactivating), pU6-(TMEM167B-shRNA-Seq1) (CAT#:LV-SI1504WQ) Recombinant lentivirus, pU6-(Human Ccl1 promoter), Overexpression (CAT#:Lenti-GTOH0677WQ) shRNA Lentivirus (self-inactivating), p7SK-(Scg2-shRNA-Seq1) (CAT#:LV-SI3972WQ) Recombinant lentivirus, pU6-(Human BDNF), Overexpression (CAT#:Lenti-GTOH0597WQ) Recombinant lentivirus, pU6-(Human hsa-miR-193a-5p), Overexpression (CAT#:Lenti-GTOH0461WQ) shRNA Lentivirus (self-inactivating), pU6-(OR5H15-shRNA-Seq1) (CAT#:LV-SI2152WQ)