shRNA Lentivirus (self-inactivating), p7SK-(SPATA19-shRNA-Seq2)(CAT#: LV-SI1167WQ)
This product is a SPATA19-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPATA19 may have a role in spermiogenesis. The expression of SPATA19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SPATA19-shRNA-Seq2 |
| Related Target/Protein | SPATA19 |
| Region | CDS |
| TargetSeq | GCTGTGTCTGTACTACATCAT |
| NCBI RefSeq | NM_174927 |
| Alternative Names | CT132; SPAS1; spergen1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Spermiogenesis |
