shRNA Lentivirus (self-inactivating), p7SK-(Srbd1-shRNA-Seq4)(CAT#: LV-SI3463WQ)
This product is a Srbd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Srbd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Srbd1-shRNA-Seq4 |
Related Target/Protein | Srbd1 |
Region | CDS |
TargetSeq | GATTCCTATCCGGTTCATAAC |
NCBI RefSeq | XM_001479682 |
Titer | >1*10^10 GC/mL |