shRNA Lentivirus (self-inactivating), p7SK-(Sval3-shRNA-Seq1)(CAT#: LV-SI3594WQ)

This product is a Sval3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Sval3 gene has the aspartic-type endopeptidase activity. The expression of Sval3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Sval3-shRNA-Seq1
Related Target/Protein Sval3
Region CDS
TargetSeq CAATAGAAACAAGTCACTTTC
NCBI RefSeq NM_001003952
Titer >1*10^10 GC/mL
Target Gene
Gene ID 387564
Uniprot ID Q76I99

Related Products