shRNA Lentivirus (self-inactivating), p7SK-(Tcte1-shRNA-Seq3)(CAT#: LV-SI3599WQ)
This product is a Tcte1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Tcte1 gene may play a role in the assembly of N-DRC and be required for sperm motility. The expression of Tcte1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Tcte1-shRNA-Seq3 |
Related Target/Protein | Tcte1 |
Region | 3UTR |
TargetSeq | GCTGACTAATTCAAACTCTTA |
NCBI RefSeq | NM_013688 |
Alternative Names | DRC5; D6S46; FAP155 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |