shRNA Lentivirus (self-inactivating), p7SK-(Tmem231-shRNA-Seq2)(CAT#: LV-SI3523WQ)

This product is a Tmem231-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Tmem231 gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Tmem231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Tmem231-shRNA-Seq2
Related Target/Protein Tmem231
Region CDS
TargetSeq GTGCTGTACTTTAAACTTGAA
NCBI RefSeq NM_001033321
Alternative Names MKS11; JBTS20; ALYE870; PRO1886
Titer >1*10^10 GC/mL
Related Diseases Joubert syndrome
Target Gene
Gene ID 79583
Uniprot ID Q9H6L2

Related Products