shRNA Lentivirus (self-inactivating), p7SK-(Tmem26-shRNA-Seq1)(CAT#: LV-SI3912WQ)
This product is a Tmem26-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Tmem26 gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. The expression of Tmem26-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Tmem26-shRNA-Seq1 |
Related Target/Protein | Tmem26 |
Region | CDS |
TargetSeq | CAGAGGCTTTGTCGACAATTT |
NCBI RefSeq | NM_177794 |
Titer | >1*10^10 GC/mL |