shRNA Lentivirus (self-inactivating), p7SK-(ZNF280C-shRNA-Seq2)(CAT#: LV-SI1446WQ)
This product is a ZNF280C-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ZNF280C gene encodes a member of the zinc finger domain-containing protein family. The expression of ZNF280C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | ZNF280C-shRNA-Seq2 |
| Related Target/Protein | ZNF280C |
| Region | CDS |
| TargetSeq | GAGCCTTGCTTTGAAGAACAT |
| NCBI RefSeq | NM_017666 |
| Alternative Names | ZPET; SUHW3; ZNF633 |
| Titer | >1*10^10 GC/mL |
