shRNA Lentivirus (self-inactivating), pH1-(2010110P09Rik-shRNA-Seq6)(CAT#: LV-SI2932WQ)
This product is a 2010110P09Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2010110P09Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | 2010110P09Rik-shRNA-Seq6 |
| Related Target/Protein | 2010110P09Rik |
| Region | CDS |
| TargetSeq | CCTAAACAGCAGAATGAACAA |
| NCBI RefSeq | XM_355937 |
| Alternative Names | Cbhp2; Chp2 |
| Titer | >1*10^10 GC/mL |
