shRNA Lentivirus (self-inactivating), pH1-(2510006D16Rik-shRNA-Seq1)(CAT#: LV-SI3075WQ)
This product is a 2510006D16Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2510006D16Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | 2510006D16Rik-shRNA-Seq1 |
Related Target/Protein | 2510006D16Rik |
Region | CDS |
TargetSeq | GAAGATATTGGTGGGAAAGAA |
NCBI RefSeq | NM_029748 |
Alternative Names | 1500002D11Rik; Tmem234; 4933407D05Rik |
Titer | >1*10^10 GC/mL |