shRNA Lentivirus (self-inactivating), pH1-(4933409G03Rik-shRNA-Seq3)(CAT#: LV-SI2645WQ)
This product is a 4933409G03Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 4933409G03Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | 4933409G03Rik-shRNA-Seq3 |
Related Target/Protein | 4933409G03Rik |
Region | CDS |
TargetSeq | CAAAGACATCTGACCACAATG |
NCBI RefSeq | NM_177651 |
Titer | >1*10^10 GC/mL |