shRNA Lentivirus (self-inactivating), pH1-(ARMC4-shRNA-Seq2)(CAT#: LV-SI0589WQ)
This product is a ARMC4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ARMC4 gene encoded protein contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. The expression of ARMC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | ARMC4-shRNA-Seq2 |
Related Target/Protein | ARMC4 |
Region | CDS |
TargetSeq | CACTGACAATAAAGAGCGGTT |
NCBI RefSeq | NM_018076 |
Alternative Names | CILD23 |
Titer | >1*10^10 GC/mL |
Related Diseases | Primary ciliary dyskensia (PCD) |