shRNA Lentivirus (self-inactivating), pH1-(C9orf23-shRNA-Seq3)(CAT#: LV-SI0820WQ)
This product is a C9orf23-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C9orf23 gene encodes a protein that appears to belong to a family of evolutionarily related proteins (DUF78), that may share one or more domains in common. The expression of C9orf23-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C9orf23-shRNA-Seq3 |
Related Target/Protein | C9orf23 |
Region | CDS |
TargetSeq | CCAAGCTACGTTTCCTTCAGA |
NCBI RefSeq | NM_148178 |
Alternative Names | RPP25L; bA296L22.5 |
Titer | >1*10^10 GC/mL |