shRNA Lentivirus (self-inactivating), pH1-(CABIN1-shRNA-Seq3)(CAT#: LV-SI0730WQ)
This product is a CABIN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by CABIN1 gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The expression of CABIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CABIN1-shRNA-Seq3 |
| Related Target/Protein | CABIN1 |
| Region | CDS |
| TargetSeq | CTGCGATTCTATGTGCGAGTA |
| NCBI RefSeq | NM_012295 |
| Alternative Names | CAIN; PPP3IN; KB-318B8.7 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Glomerular podocyte injury |
