shRNA Lentivirus (self-inactivating), pH1-(CAMSAP1-shRNA-Seq3)(CAT#: LV-SI0805WQ)
This product is a CAMSAP1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CAMSAP1 encoded protein is a key microtubule-organizing protein that specifically binds the minus-end of non-centrosomal microtubules and regulates their dynamics and organization. The expression of CAMSAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CAMSAP1-shRNA-Seq3 |
Related Target/Protein | CAMSAP1 |
Region | CDS |
TargetSeq | GCCATTAGTGTTGAAGCCGAA |
NCBI RefSeq | NM_015447 |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular Carcinoma |