shRNA Lentivirus (self-inactivating), pH1-(Cbwd1-shRNA-Seq5)(CAT#: LV-SI2805WQ)
This product is a Cbwd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Cbwd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Cbwd1-shRNA-Seq5 |
Related Target/Protein | Cbwd1 |
Region | CDS |
TargetSeq | CTATGATATTCTCTCTGGAAT |
NCBI RefSeq | NM_146097 |
Alternative Names | COBP |
Titer | >1*10^10 GC/mL |