shRNA Lentivirus (self-inactivating), pH1-(CCDC67-shRNA-Seq2)(CAT#: LV-SI0696WQ)
This product is a CCDC67-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CCDC67 gene is key structural component of the deuterosome, a structure that promotes de novo centriole amplification in multiciliated cells. The expression of CCDC67-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CCDC67-shRNA-Seq2 |
| Related Target/Protein | CCDC67 |
| Region | CDS |
| TargetSeq | GAACAAATTGACATCATGGTA |
| NCBI RefSeq | NM_181645 |
| Alternative Names | DEUP1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Papillary thyroid carcinoma, gastric cancer |
