shRNA Lentivirus (self-inactivating), pH1-(Cdc42ep2-shRNA-Seq1)(CAT#: LV-SI3061WQ)

Datasheet

This product is a Cdc42ep2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Cdc42ep2 gene is a member of the Borg family of CDC42 effector proteins. Coexpression of this protein with CDC42 suggested a role of this protein in actin filament assembly and cell shape control. The expression of Cdc42ep2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Cdc42ep2-shRNA-Seq1
Related Target/Protein Cdc42ep2
Region CDS
TargetSeq CTTTGACCTTCCCTTCCAGTT
NCBI RefSeq NM_026772
Alternative Names CEP2; BORG1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 10435
Uniprot ID O14613

Related Products

shRNA Lentivirus (self-inactivating), p7SK-(MFSD6L-shRNA-Seq1) (CAT#:LV-SI3791WQ) Recombinant lentivirus, pU6-(Human LMNA-399), Overexpression (CAT#:Lenti-GTOH0110WQ) shRNA Lentivirus (self-inactivating), p7SK-(THOC1-shRNA-Seq1) (CAT#:LV-SI1031WQ) shRNA Lentivirus (self-inactivating), p7SK-(Prb1-shRNA-Seq1) (CAT#:LV-SI4014WQ) shRNA Lentivirus (self-inactivating), p7SK-(Cyb5d2-shRNA-Seq7) (CAT#:LV-SI3742WQ) Recombinant lentivirus, pU6-(Human IL-37b), Overexpression (CAT#:Lenti-GTOH0604WQ) shRNA Lentivirus (self-inactivating), pH1-(GOLM1-shRNA-Seq4) (CAT#:LV-SI0635WQ) shRNA Lentivirus (self-inactivating), pU6-(GOLM1-shRNA-Seq2) (CAT#:LV-SI0132WQ)